TA194, TA194 (genetic_marker) Cicer arietinum

Marker Overview
NameTA194
AliasTA194s
TA194x
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TTA)21
Primer 1TA194.Forward primer: TTTTTGGCTTATTAGACTGACTT
Primer 2TA194.Reverse primer: TTGCCATAAAATACAAAATCC
Product Length132
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTA194.Forward primerCicer arietinumprimer
Reverse primerTA194.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Seed colorqSDCL.ICC3996xS95362.LG2.H.CIE_bCicer arietinumQTL
Seed colorqSDCL.ICC3996xS95362.LG2.M.CIE_bCicer arietinumQTL
Seed colorqSDCL.ICC3996xS95362.LG2.H.CCicer arietinumQTL
Seed colorqSDCL.ICC3996xS95362.LG2.M.CCicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ILC3279xWR315.LG2.2002Cicer arietinumQTL
Ascochyta blight resistanceqABR.ILC3279xWR315.LG2.2003Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA194TA194Cicer arietinummarker_locus
TA194xTA194xCicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG2N/A15.1TA194View
2chickpea-C214xWR315-F2LG2N/A11.9TA194View
3chickpea-ICC4991xICCV04516-F2LG3N/A60.9TA194View
4chickpea-ICCV2xJG62-RILLG7N/A1.7TA194View
5chickpea-ICCV96029xCDCCorinne-F2LG2N/A21TA194View
6chickpea-ICCV96029xCDCFrontier-F2LG2N/A118.5TA194View
7chickpea-ICCV96029xCDCLuna-F2LG2N/A0.8TA194View
8chickpea-JG62xVijay-RIL-2011LG5N/A81.9TA194View
9chickpea-JG62xVijay-VijayxICC4958-RILLG3N/A58.3TA194View
10chickpea-ICC4958xPI489777-RIL-2011LG2N/A51TA194View
11chickpea-ICC4958xPI489777-RIL-F10LG2N/A47.08TA194View
12chickpea-ICCV96029xCDCFrontier-F2-2007LG2N/A118.5TA194View
13chickpea-HadasxICC5810-RILLG2N/A0TA194View
14chickpea-HadasxCr205-F2LG2BN/A16.4TA194View
15chickpea-ILC3279xWR315-RIL-2007LG2N/A45TA194View
16chickpea-ICC4958xPI489777-RIL-F10-2012LG02N/A44.55TA194View
17chickpea-ICC3996xILWC184-F2LG2N/A11.2TA194View
18chickpea-ILC72xCr5-10-RIL-2014LG2N/A136.4TA194View
19chickpea-ICC4958xPI489777-RIL-2010LG2N/A166.5TA194View
20Chickpea-JG62_X_WR315-RILLG2N/A90.6TA194View
21Chickpea-RIP5-OrtegaLG02N/A5.4TA194View
22Chickpea-RIP8-OrtegaLG02-1N/A20.1TA194View
23chickpea-JG62xVijay-RIL-2011LG5N/A83.1TA194xView