TA2, TA2 (genetic_marker) Cicer arietinum

Marker Overview


Name	TA2
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)16TGA(TAA)19
Primer 1	TA2.Forward primer: AAATGGAAGAAGAATAAAAACGAAAC
Primer 2	TA2.Reverse primer: TTCCATTCTTTATTATCCATATCACTACA
Product Length	175
Publication	[view all]

Publications


Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2013	Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133.

Germplasm


Stock Name	Type
ILC3279	accession

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-C214xILC3279-F2	LG4	N/A	36.2	TA2	View
2	chickpea-ICC4991xICCV04516-F2	LG4	N/A	48.7	TA2	View
3	chickpea-ICCV2xJG62-RIL	LG6	N/A	0	TA2	View
4	chickpea-ICCV96029xAmit-F2	LG4	N/A	50	TA2	View
5	chickpea-ICCV96029xCDCCorinne-F2	LG4	N/A	11	TA2	View
6	chickpea-ICCV96029xCDCFrontier-F2	LG4	N/A	120.2	TA2	View
7	chickpea-ICCV96029xCDCLuna-F2	LG4	N/A	82.2	TA2	View
8	chickpea-JG62xVijay-RIL-2011	LG1	N/A	76	TA2	View
9	chickpea-JG62xVijay-VijayxICC4958-RIL	LG2	N/A	57.8	TA2	View
10	chickpea-VijayxICC4958-RIL-2011	LG1a	N/A	81.8	TA2	View
11	chickpea-ICCV2xJG62-RIL-F10-2011	LGIV	N/A	37.8	TA2	View
12	chickpea-ICC4958xPI489777-RIL-F10	LG4	N/A	72.39	TA2	View
13	chickpea-Hadas-2010	LG4	N/A	3.7	TA2	View
14	chickpea-ICCV96029xCDCFrontier-F2-2007	LG4	N/A	120.2	TA2	View
15	chickpea-HadasxICC5810-RIL	LG4	N/A	3.7	TA2	View
16	chickpea-HadasxCr205-F2	LG4B	N/A	27	TA2	View
17	chickpea-ILC72xCr5-10-RIL-2006	LG4	N/A	97.3	TA2	View
18	chickpea-ICC4958xPI489777-RIL-F10-2012	LG04	N/A	40.92	TA2	View
19	chickpea-ICC12004xLasseter-F2	LGIII	N/A	45.3	TA2	View
20	chickpea-ICC3996xILWC184-F2	LG4	N/A	13	TA2	View
21	chickpea-LasseterxICC3996-F6-RIL	LG4.1	N/A	30.6	TA2	View
22	chickpea-ILC588xILC3279-RIL-F6	LG4	N/A	0.4	TA2	View
23	chickpea-ICC4958xPI489777-RIL-2010	LG4	N/A	245.4	TA2	View
24	Chickpea-RIP5-Ortega	LG04-2	N/A	0	TA2	View

Search form