TA200, TA200 (genetic_marker) Cicer arietinum

Marker Overview
NameTA200
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TTA)37
Primer 1TA200.Forward primer: TTTCTCCTCTACTATTATGATCACCAG
Primer 2TA200.Reverse primer: TTGAGAGGGTTAGAACTCATTATGTTT
Product Length296
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA200.Forward primerTA200.Forward primerCicer arietinumprimer
TA200.Reverse primerTA200.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
100-seed weightqSDWT.ICCV2xJG62.LG2.5LCCicer arietinumQTL
Harvest indexqHI.ICCV2xJG62.LG2.5ESCicer arietinumQTL
Ascochyta blight resistanceqABR.P1359075xFLIP84-92C.LG2BCicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA200TA200Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xWR315-F2LG2N/A30.7TA200View
2chickpea-ICC4991xICCV04516-F2LG2N/A70.1TA200View
3chickpea-ICCV2xJG62-RILLG2N/A0TA200View
4chickpea-ICCV96029xCDCCorinne-F2LG2N/A49.1TA200View
5chickpea-ICCV96029xCDCFrontier-F2LG2N/A155.6TA200View
6chickpea-ICCV96029xCDCFrontier-F2-2007LG2N/A155.6TA200View
7chickpea-HadasxCr205-F2LG2BN/A37.7TA200View
8chickpea-ICC12004xLasseter-F2LGIN/A20.2TA200View
9chickpea-ILC588xILC3279-RIL-F6LG2N/A0TA200View
10chickpea-ICC16641×CDCFrontier-F2-2017CaLG02N/A32.2TA200View
11chickpea-flowering_time_consensus_map-F2-2017CaLG02N/A27TA200View
12Chickpea-ICC4958× ICC1882-RILCaLG02N/A24.26TA200View