|
Marker Overview
Name | TA200 |
Genbank ID | N/A |
Type | STMS |
Species | Cicer arietinum |
Germplasm | ILC3279 |
Repeat Motif | (TTA)37 |
Primer 1 | TA200.Forward primer: TTTCTCCTCTACTATTATGATCACCAG |
Primer 2 | TA200.Reverse primer: TTGAGAGGGTTAGAACTCATTATGTTT |
Product Length | 296 |
Publication | [view all] |
Relationships
This genetic_marker is adjacent to the following primer feature(s):
Feature Name | Unique Name | Species | Type |
TA200.Forward primer | TA200.Forward primer | Cicer arietinum | primer |
TA200.Reverse primer | TA200.Reverse primer | Cicer arietinum | primer |
This genetic_marker is adjacent to the following QTL feature(s):
The following marker_locus feature(s) are an instance of this genetic_marker:
Publications
Year | Publication |
1999 | Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101. |
2013 | Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133. |
Germplasm
Stock Name | Type |
ILC3279 | breeding_research_material |
|