TA203, TA203 (genetic_marker) Cicer arietinum

Marker Overview
NameTA203
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)43
Primer 1TA203.Forward primer: ATAAAGGTTTGATCCCCATT
Primer 2TA203.Reverse primer: TGTGCATTCAGATACATGCT
Product Length217
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA203.Forward primerTA203.Forward primerCicer arietinumprimer
TA203.Reverse primerTA203.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Stem dry weightqSHWT.ICCV2xJG62.LG1.7ESCicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Plant heightqPLHGT.ILC588xILC3279.LG1.Terbol-11Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LG1.TH-cont08Cicer arietinumQTL
Harvest indexqHI.ILC588xILC3279.LG1.Breda-10Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA203TA203Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4991xICCV04516-F2LG1N/A29.9TA203View
2chickpea-ICCV2xJG62-RILLG1N/A4.9TA203View
3chickpea-ICCV96029xCDCCorinne-F2LG1N/A32.2TA203View
4chickpea-ICCV96029xCDCFrontier-F2LG1N/A58.9TA203View
5chickpea-ICCV96029xCDCLuna-F2LG1N/A28.5TA203View
6chickpea-ICC4958xPI489777-RIL-2012LG1N/A129.5TA203View
7chickpea-ICCV2xJG62-RIL-F10-2011LGIN/A33.1TA203View
8chickpea-ICC4958xPI489777-RIL-2012-2LG1N/A190.6TA203View
9chickpea-ICCV96029xCDCFrontier-F2-2007LG1N/A58.9TA203View
10chickpea-ICC4958xPI489777-RIL-F10-2012LG01N/A40.74TA203View
11chickpea-ICC12004xLasseter-F2LGIIN/A5.3TA203View
12chickpea-ICC3996xILWC184-F2LG1N/A14.9TA203View
13chickpea-ICC4958xPI489777-RIL-2010LG1N/A186.9TA203View
14chickpea-ICC4958xPI489777-RIL-2015-2LG1N/A18.84TA203View
15Chickpea-JG62/ICCV05530-RILLG01N/A0TA203View