|
|
Marker Overview
| Name | TA21 |
|---|
| Genbank ID | N/A |
|---|
| Type | STMS |
|---|
| Species | Cicer arietinum |
|---|
| Germplasm | ILC3279 |
|---|
| Repeat Motif | (TAA)51 |
|---|
| Primer 1 | TA21.Forward primer: GTACCTCGAAGATGTAGCCGATA |
|---|
| Primer 2 | TA21.Reverse primer: TTTTCCATTTAGAGTAGGATCTTCTTG |
|---|
| Product Length | 347 |
|---|
| Publication | [view all] |
|---|
Publications
| Year | Publication |
|---|
| 1999 | Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101. |
| 2015 | Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7. |
|
