TA22, TA22 (genetic_marker) Cicer arietinum

Marker Overview
NameTA22
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(ATT)40
Primer 1TA22.Forward primer: TCTCCAACCCTTTAGATTGA
Primer 2TA22.Reverse primer: TCGTGTTTACTGAATGTGGA
Product Length228
Publication[view all]
Comment17984
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA22.Forward primerTA22.Forward primerCicer arietinumprimer
TA22.Reverse primerTA22.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Seed yield per plantqSYPL.ICCV2xJG62.LG3.7LCCicer arietinumQTL
Ascochyta blight resistanceqABR.ICCV96029xCDCFrontier.LG6Cicer arietinumQTL
Fusarium wilt resistanceqFWR.C214xWR315.LG6.APR.2Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA22TA22Cicer arietinummarker_locus
TA22TA22-35.95Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG6N/A80.9TA22View
2chickpea-C214xWR315-F2LG6N/A41.8TA22View
3chickpea-ICC4991xICCV04516-F2LG6N/A42.3TA22View
4chickpea-ICCV2xJG62-F10-RILLG6AN/A33TA22View
5chickpea-ICCV2xJG62-RILLG3N/A18.6TA22View
6chickpea-ICCV96029xCDCCorinne-F2LG6N/A52.3TA22View
7chickpea-ICCV96029xCDCFrontier-F2LG6N/A143.9TA22View
8chickpea-ICCV96029xCDCLuna-F2LG6N/A37.1TA22View
9chickpea-JG62xVijay-VijayxICC4958-RILLG4N/A49.6TA22View
10chickpea-VijayxICC4958-RIL-2011LG4N/A11.4TA22View
11chickpea-ICC4958xPI489777-RIL-2012LG6N/A194.3TA22View
12chickpea-ICCV2xJG62-RIL-F10-2011LGVIN/A26.9TA22View
13chickpea-ICC4958xPI489777-RIL-2012-2LG6N/A27.9TA22View
14chickpea-ICC4958xPI489777-RIL-F10LG6N/A75.32TA22View
15chickpea-ICCV96029xCDCFrontier-F2-2007LG6N/A143.9TA22View
16chickpea-HadasxCr205-F2LG6BN/A27.5TA22View
17chickpea-ICC12004xLasseter-F2LGVIIIN/A0TA22View
18chickpea-ICC3996xILWC184-F2LG6N/A41.2TA22View
19chickpea-LasseterxICC3996-F6-RILLG6.1N/A52TA22View
20chickpea-S95362xHowzat-F6-RILLG6N/A36.3TA22View
21chickpea-ILC588xILC3279-RIL-F6LG6N/A0TA22View
22chickpea-ICC4958xPI489777-RIL-2010LG6N/A127.4TA22View
23chickpea-ICC4958xPI489777-RIL-2015-2LG6N/A84.08TA22View
24Chickpea-RIP-1_x_RIP-1-RIL-geneticLG6N/A19.6TA22View
25chickpea-ICCV96029×CDCFrontier-F2-2017CaLG06N/A28.5TA22View
26chickpea-ICC5810×CDCFrontier-F2-2017CaLG06N/A29TA22View
27chickpea-BGD132×CDCFrontier-F2-2017CaLG06N/A31.1TA22View
28chickpea-ICC16641×CDCFrontier-F2-2017CaLG06N/A26.1TA22View
29chickpea-flowering_time_consensus_map-F2-2017CaLG06N/A30.8TA22View
30Chickpea-ICC4958/PI489777-RIL-2020LG06N/A179.21TA22View
31Chickpea-JG62/ICCV05530-RILLG06N/A35.95TA22View