TA27, TA27 (genetic_marker) Cicer arietinum

Marker Overview
NameTA27
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)21
Primer 1TA27.Forward primer: GATAAAATCATTATTGGGTGTCCTTT
Primer 2TA27.Reverse primer: TTCAAATAATCTTTCATCAGTCAAATG
Product Length241
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTA27.Forward primerCicer arietinumprimer
Reverse primerTA27.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA27TA27Cicer arietinummarker_locus
TA27TA27-13.78Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG2N/A34.6TA27View
2chickpea-ICC4991xICCV04516-F2LG2N/A47.8TA27View
3chickpea-ICCV2xJG62-RILLG2N/A5.1TA27View
4chickpea-ICC4958xPI489777-RIL-2011LG2N/A64.7TA27View
5chickpea-ICC4958xPI489777-RIL-2012LG2N/A66.1TA27View
6chickpea-ICCV2xJG62-RIL-F10-2011LGVIIIN/A44.2TA27View
7chickpea-ICC4958xPI489777-RIL-2012-2LG2N/A61.2TA27View
8chickpea-ICC4958xPI489777-RIL-F10LG2N/A55.61TA27View
9chickpea-HadasxICC5810-RILLG2N/A22.6TA27View
10chickpea-HadasxCr205-F2LG2BN/A37.7TA27View
11chickpea-ICC4958xPI489777-RIL-F10-2012LG02N/A48.23TA27View
12chickpea-ICC3996xILWC184-F2LG2N/A0.5TA27View
13chickpea-LasseterxICC3996-F6-RILLG2.2N/A30.9TA27View
14chickpea-S95362xHowzat-F6-RILLG2.2N/A24.3TA27View
15chickpea-ILC588xILC3279-RIL-F6LG2N/A1.8TA27View
16chickpea-ICC4958xPI489777-RIL-2010LG2N/A119.4TA27View
17chickpea-ICC4958xPI489777-RIL-2015-2LG2N/A68.42TA27View
18Chickpea-ICCL81001_x_Cr5-9-RILLG2N/A44.4TA27View
19Chickpea-JG62_X_WR315-RILLG2N/A0TA27View
20Chickpea-ICC4958× ICC1882-RILCaLG02N/A34.72TA27View
21Chickpea-JG62/ICCV05530-RILLG02N/A13.78TA27-13.78View