TA3, TA3 (genetic_marker) Cicer arietinum

Marker Overview
NameTA3
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)11
Primer 1TA3.Forward primer: AATCTCAAAATTCCCCAAAT
Primer 2TA3.Reverse primer: ATCGAGGAGAGAAGAACCAT
Product Length287
Publication[view all]
ContactVincent Vadez
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTA3.Forward primerCicer arietinumprimer
Reverse primerTA3.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICC12004xLasseter.LG2.cont.IDSCicer arietinumQTL
Ascochyta blight resistanceqABR.ICC12004xLasseter.LG2.cont.AUDCPCicer arietinumQTL
Didymella rabiei resistance effect on days to first flowerqRDR-DFFL.HadasxICC5810.LG8.GilatCicer arietinumQTL
Didymella rabiei resistance effect on days to first flowerqRDR-DFFL.HadasxICC5810.LG8.MassuotCicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA3TA3Cicer arietinummarker_locus


Contact
NameDetails
Vincent Vadez
First name:Vincent
Last name:Vadez
Title:Researcher
Institution:International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)
Address:International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Andhra Pradesh 502 324, India
Country:India
Email:v.vadez@cgiar.org
Germplasm
Stock NameType
ILC3279breeding_research_material