|
Marker Overview
Name | TA3 |
Genbank ID | N/A |
Type | STMS |
Species | Cicer arietinum |
Germplasm | ILC3279 |
Repeat Motif | (TAA)11 |
Primer 1 | TA3.Forward primer: AATCTCAAAATTCCCCAAAT |
Primer 2 | TA3.Reverse primer: ATCGAGGAGAGAAGAACCAT |
Product Length | 287 |
Publication | [view all] |
Contact | Vincent Vadez
|
Publications
Year | Publication |
1999 | Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101. |
2018 | Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29. |
2013 | Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133. |
|