TA37, TA37 (genetic_marker) Cicer arietinum

Marker Overview
NameTA37
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TTA)20
Primer 1TA37.Forward primer: ACTTACATGAATTATCTTTCTTGGTCC
Primer 2TA37.Reverse primer: CGTATTCAAATAATCTTTCATCAGTCA
Product Length282
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA37.Forward primerTA37.Forward primerCicer arietinumprimer
TA37.Reverse primerTA37.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
100-seed weightqSDWT.ICCV2xJG62.LG2.5LCCicer arietinumQTL
Harvest indexqHI.ICCV2xJG62.LG2.5ESCicer arietinumQTL
Ascochyta blight resistanceqABR.P1359075xFLIP84-92C.LG2BCicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA37TA37Cicer arietinummarker_locus
TA37TA37-14.08Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG2N/A44.1TA37View
2chickpea-ICC4991xICCV04516-F2LG2N/A29.7TA37View
3chickpea-ICCV2xJG62-RILLG2N/A4.4TA37View
4chickpea-ICCV96029xCDCFrontier-F2LG2N/A124.9TA37View
5chickpea-ILC3279xICCV2-F3LG2N/A48.2TA37View
6chickpea-JG62xVijay-RIL-2011LG5N/A54TA37View
7chickpea-JG62xVijay-VijayxICC4958-RILLG3N/A30.3TA37View
8chickpea-ICC4958xPI489777-RIL-2012LG2N/A57.5TA37View
9chickpea-ICC4958xPI489777-RIL-2012-2LG2N/A54.6TA37View
10chickpea-ICC4958xPI489777-RIL-F10LG2N/A57.37TA37View
11chickpea-ICCV96029xCDCFrontier-F2-2007LG2N/A124.9TA37View
12chickpea-ILC3279xWR315-RIL-2007LG2N/A30.8TA37View
13chickpea-ICC4958xPI489777-RIL-F10-2012LG02N/A46.35TA37View
14chickpea-ICC12004xLasseter-F2LGIN/A23.9TA37View
15chickpea-ICC3996xILWC184-F2LG2N/A23.4TA37View
16chickpea-ILC588xILC3279-RIL-F6LG2N/A5.3TA37View
17chickpea-ICC4958xPI489777-RIL-2010LG2N/A217.1TA37View
18chickpea-ICC4958xPI489777-RIL-2015-2LG2N/A69.86TA37View
19Chickpea-JG62xVijayxVijayxICC4958-RILLG3 (LGII+VIII)N/A30.3TA37View
20Chickpea-JG62_X_WR315-RILLG2N/A159.1TA37View
21Chickpea-ICC4958× ICC1882-RILCaLG02N/A31.53TA37View
22Chickpea-JG62/ICCV05530-RILLG02N/A14.08TA37-14.08View