TA39, TA39 (genetic_marker) Cicer arietinum

Marker Overview
NameTA39
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)20
Primer 1TA39.Forward primer: TTAGCGTGGCTAACTTTATTTGC
Primer 2TA39.Reverse primer: ATAAATATCCAATTCTGGTAGTTGACG
Product Length249
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTA39.Forward primerCicer arietinumprimer
Reverse primerTA39.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA39TA39Cicer arietinummarker_locus
TA39TA39-25.04Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4991xICCV04516-F2LG5AN/A68.1TA39View
2chickpea-ICCV96029xCDCFrontier-F2LG5N/A93TA39View
3chickpea-ICC4958xPI489777-RIL-2012LG5N/A208.5TA39View
4chickpea-ICC4958xPI489777-RIL-2012-2LG5N/A43.2TA39View
5chickpea-ICC4958xPI489777-RIL-F10LG5N/A93.08TA39View
6chickpea-ICCV96029xCDCFrontier-F2-2007LG5N/A93TA39View
7chickpea-ICC4958xPI489777-RIL-F10-2012LG05N/A85TA39View
8chickpea-LasseterxICC3996-F6-RILLG5N/A0TA39View
9chickpea-S95362xHowzat-F6-RILLG1.1/5N/A94.8TA39View
10chickpea-ILC588xILC3279-RIL-F6LG5N/A0.8TA39View
11chickpea-ICC4958xPI489777-RIL-2010LG5N/A173.5TA39View
12chickpea-ICC4958xPI489777-RIL-2015-2LG5N/A43.53TA39View
13Chickpea-CA2156_x_JG62-RILRIP-1 LG5N/A0TA39View
14Chickpea-ILC3279_x_JG62-RILRIP-7 LG5N/A3.4TA39View
15Chickpea-JG62_x_ILC72-RILRIP-10 LG5N/A15.4TA39View
16Chickpea-Physical_consensusCa5N/A10070772TA39View
17Chickpea-ICCL81001_x_Cr5-9-RILLG5N/A83.4TA39View
18Chickpea-RIP12-OrtegaLG05N/A3TA39View
19Chickpea-ICC4958/PI489777-RIL-2020LG05N/A170.24TA39View
20Chickpea-JG62/ICCV05530-RILLG05N/A25.04TA39-25.04View