TA64, TA64 (genetic_marker) Cicer arietinum

Name	TA64
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)39
Primer 1	TA64.Forward primer: ATATATCGTAACTCATTAATCATCCGC
Primer 2	TA64.Reverse primer: AAATTGTTGTCATCAAATGGAAAATA
Product Length	239
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2013	Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133.
2007	Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-C214xILC3279-F2	LG3	N/A	58.9	TA64	View
2	chickpea-ICC4991xICCV04516-F2	LG3	N/A	0	TA64	View
3	chickpea-ICCV96029xAmit-F2	LG3	N/A	50.4	TA64	View
4	chickpea-ICCV96029xCDCCorinne-F2	LG3	N/A	46.3	TA64	View
5	chickpea-ICCV96029xCDCFrontier-F2	LG3	N/A	72.8	TA64	View
6	chickpea-ICCV96029xCDCLuna-F2	LG3	N/A	55.5	TA64	View
7	chickpea-JG62xVijay-RIL-2011	LG2	N/A	19.1	TA64	View
8	chickpea-JG62xVijay-VijayxICC4958-RIL	LG1	N/A	113.1	TA64	View
9	chickpea-VijayxICC4958-RIL-2011	LG1a	N/A	92.6	TA64	View
10	chickpea-ICCV2xJG62-RIL-F10-2011	LGIII	N/A	29.8	TA64	View
11	chickpea-ICC4958xPI489777-RIL-2012-2	LG3	N/A	126.8	TA64	View
12	chickpea-ICC4958xPI489777-RIL-F10	LG3	N/A	51.29	TA64	View
13	chickpea-ICCV96029xCDCFrontier-F2-2007	LG3	N/A	72.8	TA64	View
14	chickpea-HadasxCr205-F2	LG3B	N/A	23.5	TA64	View
15	chickpea-ICC4958xPI489777-RIL-F10-2012	LG03	N/A	63.86	TA64	View
16	chickpea-ICC3996xILWC184-F2	LG3	N/A	59.6	TA64	View
17	chickpea-LasseterxICC3996-F6-RIL	LG3	N/A	31.3	TA64	View
18	chickpea-S95362xHowzat-F6-RIL	LG3	N/A	34.6	TA64	View
19	chickpea-ICC4958xPI489777-RIL-2010	LG3	N/A	175.6	TA64	View
20	chickpea-ICC4958xPI489777-RIL-2015-2	LG3	N/A	48.39	TA64	View
21	Chickpea-JG62xVijayxVijayxICC4958-RIL	LG1 (LGIII+V+XIII)	N/A	113.1	TA64	View
22	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG03	N/A	43.7	TA64	View
23	chickpea-ICC5810×CDCFrontier-F2-2017	CaLG03	N/A	40.9	TA64	View
24	chickpea-BGD132×CDCFrontier-F2-2017	CaLG03	N/A	41.7	TA64	View
25	chickpea-ICC16641×CDCFrontier-F2-2017	CaLG03	N/A	34.6	TA64	View
26	chickpea-flowering_time_consensus_map-F2-2017	CaLG03	N/A	24.2	TA64	View
27	Chickpea-ICCL81001_x_Cr5-9-RIL	LG3A	N/A	0	TA64	View
28	Chickpea-ICC4958× ICC1882-RIL	CaLG03	N/A	12.6	TA64	View
29	Chickpea-RIP12-Ortega	LG03-2	N/A	1.6	TA64	View
30	Chickpea-RIP8-Ortega	LG03-2	N/A	21.2	TA64	View
31	Chickpea-ICC4958/PI489777-RIL-2020	LG03	N/A	130.12	TA64	View