TA71, TA71 (genetic_marker) Cicer arietinum

Marker Overview
NameTA71
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(AAT)32
Primer 1TA71.Forward primer: CGATTTAACACAAAACACAAA
Primer 2TA71.Reverse primer: CCTATCCATTGTCATCTCGT
Product Length225
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTA71.Forward primerCicer arietinumprimer
Reverse primerTA71.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA71TA71Cicer arietinummarker_locus
TA71TA71-15.71Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG5BN/A38.7TA71View
2chickpea-C214xWR315-F2LG5N/A66.5TA71View
3chickpea-ICCV2xJG62-RILLG7N/A1.7TA71View
4chickpea-ICC4958xPI489777-RIL-2011LG5N/A83.6TA71View
5chickpea-ICC4958xPI489777-RIL-2012LG5N/A206TA71View
6chickpea-ICC4958xPI489777-RIL-2012-2LG5N/A49.3TA71View
7chickpea-ICC4958xPI489777-RIL-F10LG5N/A87.64TA71View
8chickpea-ICC4958xPI489777-RIL-F10-2012LG05N/A80.12TA71View
9chickpea-ICC12004xLasseter-F2LGVIIN/A18.9TA71View
10chickpea-ICC3996xILWC184-F2LG5N/A16.1TA71View
11chickpea-LasseterxICC3996-F6-RILLG5N/A3.5TA71View
12chickpea-ICC4958xPI489777-RIL-2010LG5N/A171.3TA71View
13chickpea-ICC4958xPI489777-RIL-2015-2LG5N/A45.86TA71View
14chickpea-ICCV96029×CDCFrontier-F2-2017CaLG05N/A0TA71View
15chickpea-ICC5810×CDCFrontier-F2-2017CaLG05N/A0TA71View
16chickpea-BGD132×CDCFrontier-F2-2017CaLG05N/A2.6TA71View
17chickpea-ICC16641×CDCFrontier-F2-2017CaLG05N/A0TA71View
18chickpea-flowering_time_consensus_map-F2-2017CaLG05N/A0TA71View
19Chickpea-CA2156_x_JG62-RILRIP-1 LG5N/A48.3TA71View
20Chickpea-ILC3279_x_JG62-RILRIP-7 LG5N/A20.8TA71View
21Chickpea-Physical_consensusCa5N/A24073784TA71View
22Chickpea-ICCL81001_x_Cr5-9-RILLG5N/A99.2TA71View
23Chickpea_SBD377_X_BGD112_RILLG5N/A115TA71View
24Chickpea-RIP12-OrtegaLG05N/A5TA71View
25Chickpea-SBD377/BGD112-RIL-High_densityLG05N/A56.37TA71View
26Chickpea-ICC4958/PI489777-RIL-2020LG05N/A170.26TA71View
27Chickpea-JG62/ICCV05530-RILLG05N/A15.71TA71View