TA72, TA72 (genetic_marker) Cicer arietinum

Name	TA72
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(ATT)36
Primer 1	TA72.Forward primer: GAAAGATTTAAAAGATTTTCCACGTTA
Primer 2	TA72.Reverse primer: TTAGAAGCATATTGTTGGGATAAGAGT
Product Length	256
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2013	Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133.
2007	Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-C214xWR315-F2	LG4	N/A	12.9	TA72	View
2	chickpea-ICC4991xICCV04516-F2	LG4	N/A	21.5	TA72	View
3	chickpea-ICCV2xJG62-RIL	LG6	N/A	44.1	TA72	View
4	chickpea-ICCV96029xAmit-F2	LG4	N/A	44.5	TA72	View
5	chickpea-ICCV96029xCDCCorinne-F2	LG4	N/A	7.9	TA72	View
6	chickpea-ICCV96029xCDCFrontier-F2	LG4	N/A	113.7	TA72	View
7	chickpea-ICCV96029xCDCLuna-F2	LG4	N/A	76.2	TA72	View
8	chickpea-ILC588xILC3279-RIL	LG4	N/A	23.4	TA72	View
9	chickpea-JG62xVijay-RIL-2011	LG1	N/A	67.9	TA72	View
10	chickpea-JG62xVijay-VijayxICC4958-RIL	LG2	N/A	63.2	TA72	View
11	chickpea-ICC4958xPI489777-RIL-2011	LG4	N/A	51.7	TA72	View
12	chickpea-ICC4958xPI489777-RIL-2012	LG4	N/A	48.7	TA72	View
13	chickpea-ICCV2xJG62-RIL-F10-2011	LGIV	N/A	48.4	TA72	View
14	chickpea-ICC4958xPI489777-RIL-2012-2	LG4	N/A	76.7	TA72	View
15	chickpea-ICC4958xPI489777-RIL-F10	LG4	N/A	73.06	TA72	View
16	chickpea-ICCV96029xCDCFrontier-F2-2007	LG4	N/A	113.7	TA72	View
17	chickpea-ILC3279xWR315-RIL	LG4b	N/A	17.5	TA72	View
18	chickpea-ILC72xCr5-10-RIL-2006	LG4	N/A	85.7	TA72	View
19	chickpea-ICC4958xPI489777-RIL-F10-2012	LG04	N/A	42.91	TA72	View
20	chickpea-LasseterxICC3996-F6-RIL	LG4.1	N/A	35.1	TA72	View
21	chickpea-S95362xHowzat-F6-RIL	LG4	N/A	54.7	TA72	View
22	chickpea-ILC588xILC3279-RIL-F6	LG4	N/A	2.8	TA72	View
23	chickpea-ICC4958xPI489777-RIL-2010	LG4	N/A	244.1	TA72	View
24	chickpea-ICC4958xPI489777-RIL-2015-2	LG4	N/A	85.87	TA72	View
25	Chickpea-JG62xVijayxVijayxICC4958-RIL	LG2 (LGI+IV)	N/A	63.2	TA72	View
26	Chickpea-ICCL81001_x_Cr5-9-RIL	LG4	N/A	191.9	TA72	View
27	Chickpea-K850xWR315-RIL	LG1	N/A	170.3	TA72	View
28	Chickpea-RIP12-Ortega	LG04	N/A	9	TA72	View
29	Chickpea-RIP5-Ortega	LG04-2	N/A	1.8	TA72	View
30	Chickpea-RIP8-Ortega	LG04-2	N/A	13.3	TA72	View
31	Chickpea-ICC4958/PI489777-RIL-2020	LG04	N/A	164.77	TA72	View