TA8, TA8 (genetic_marker) Cicer arietinum

Marker Overview
NameTA8
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)44
Primer 1TA8.Forward primer: AAAATTTGCACCCACAAAATATG
Primer 2TA8.Reverse primer: CTGAAAATTATGGCAGGGAAAC
Product Length246
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTA8.Forward primerCicer arietinumprimer
Reverse primerTA8.Reverse primerCicer arietinumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Seed yield per plantqSYPL.ILC588xILC3279.LG1.TH06Cicer arietinumQTL
Days to 50% floweringqDFTFL.ILC588xILC3279.LG1.TH06Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LG1.TH06Cicer arietinumQTL
Number of days between flowering and physiological maturityqRP.ILC588xILC3279.LG1.TH06Cicer arietinumQTL
Plant heightqPLHGT.ILC588xILC3279.LG1.TH06Cicer arietinumQTL
Harvest indexqHI.ILC588xILC3279.LG1.TH06Cicer arietinumQTL
Drought tolerance indexqDTI.ILC588xILC3279.LG1.TH06Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA8TA8Cicer arietinummarker_locus
TA8TA8-12.3Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material