TA80, TA80 (genetic_marker) Cicer arietinum

Marker Overview
NameTA80
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TTA)23
Primer 1TA80.Forward primer: CGAATTTTTACATCCGTAATG
Primer 2TA80.Reverse primer: AATCAATCCATTTTGCATTC
Product Length211
Publication[view all]
Comment17984
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTA80.Forward primerCicer arietinumprimer
Reverse primerTA80.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICCV96029xCDCFrontier.LG6Cicer arietinumQTL
Fusarium wilt incidenceqFWI.JG62/ICCV05530.LG6.PaCicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA80TA80Cicer arietinummarker_locus
TA80TA80-36.48Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG6N/A84.3TA80View
2chickpea-ICC4991xICCV04516-F2LG6N/A33.5TA80View
3chickpea-ICCV2xJG62-F10-RILLG6AN/A38TA80View
4chickpea-ICCV2xJG62-RILLG3N/A18.6TA80View
5chickpea-ICCV96029xAmit-F2LG6N/A44.1TA80View
6chickpea-ICCV96029xCDCCorinne-F2LG6N/A49.5TA80View
7chickpea-ICCV96029xCDCFrontier-F2LG6N/A138.3TA80View
8chickpea-ICCV96029xCDCLuna-F2LG6N/A38.3TA80View
9chickpea-JG62xVijay-RIL-2011LG4N/A41.5TA80View
10chickpea-JG62xVijay-VijayxICC4958-RILLG4N/A57.4TA80View
11chickpea-VijayxICC4958-RIL-2011LG4N/A42.7TA80View
12chickpea-ICC4958xPI489777-RIL-2012LG6N/A193.1TA80View
13chickpea-ICCV2xJG62-RIL-F10-2011LGVIN/A33TA80View
14chickpea-ICC4958xPI489777-RIL-2012-2LG6N/A28TA80View
15chickpea-ICCV96029xCDCFrontier-F2-2007LG6N/A138.3TA80View
16chickpea-HadasxCr205-F2LG6BN/A27.5TA80View
17chickpea-ICC4958xPI489777-RIL-F10-2012LG06N/A52.32TA80View
18chickpea-ICC12004xLasseter-F2LGVIIIN/A6.4TA80View
19chickpea-ICC3996xILWC184-F2LG6N/A39.6TA80View
20chickpea-LasseterxICC3996-F6-RILLG6.1N/A52.8TA80View
21chickpea-S95362xHowzat-F6-RILLG6N/A36.3TA80View
22chickpea-ILC588xILC3279-RIL-F6LG6N/A3.6TA80View
23chickpea-ICC4958xPI489777-RIL-2010LG6N/A127.4TA80View
24chickpea-ICC4958xPI489777-RIL-2015-2LG6N/A85.43TA80View
25Chickpea-RIP-1_x_RIP-1-RIL-geneticLG6N/A21TA80View
26chickpea-ICCV96029×CDCFrontier-F2-2017CaLG06N/A27.8TA80View
27chickpea-ICC5810×CDCFrontier-F2-2017CaLG06N/A29.3TA80View
28chickpea-flowering_time_consensus_map-F2-2017CaLG06N/A30.1TA80View
29Chickpea_SBD377_X_BGD112_RILLG6N/A92TA80View
30Chickpea-SBD377/BGD112-RIL-High_densityLG06N/A99.96TA80View
31Chickpea-ICC4958/PI489777-RIL-2020LG06N/A179.22TA80View
32Chickpea-JG62/ICCV05530-RILLG06N/A36.48TA80View