TA96, TA96 (genetic_marker) Cicer arietinum

Marker Overview
Genbank IDN/A
SpeciesCicer arietinum
Repeat Motif(AT)3(TTA)30(AT)3
Primer 1TA96.Forward primer: TGTTTTGGAGAAGAGTGATTC
Primer 2TA96.Reverse primer: TGTGCATGCAAATTCTTACT
Product Length275
Publication[view all]

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA96.Forward primerTA96.Forward primerCicer arietinumprimer
TA96.Reverse primerTA96.Reverse primerCicer arietinumprimer

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Stem dry weightqSHWT.ICCV2xJG62.LG3.7LCCicer arietinumQTL

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Plant widthqPLWTH.JG62xVijay.LG5.PCicer arietinumQTL
Plant heightqPLHGT.ILC588xILC3279.LG2.Breda-10Cicer arietinumQTL

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA96TA96Cicer arietinummarker_locus
TA96TA96-13.96Cicer arietinummarker_locus
TA96_olaTA96_olaCicer arietinummarker_locus

Stock NameType
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
25Chickpea-JG62xVijayxVijayxICC4958-RILLG3 (LGII+VIII)N/A10.8TA96View
28Chickpea-ICC4958× ICC1882-RILCaLG02N/A33.99TA96View