TA96, TA96 (genetic_marker) Cicer arietinum

Marker Overview
NameTA96
AliasTA96s
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(AT)3(TTA)30(AT)3
Primer 1TA96.Forward primer: TGTTTTGGAGAAGAGTGATTC
Primer 2TA96.Reverse primer: TGTGCATGCAAATTCTTACT
Product Length275
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TA96.Forward primerTA96.Forward primerCicer arietinumprimer
TA96.Reverse primerTA96.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Stem dry weightqSHWT.ICCV2xJG62.LG3.7LCCicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Plant widthqPLWTH.JG62xVijay.LG5.PCicer arietinumQTL
Plant heightqPLHGT.ILC588xILC3279.LG2.Breda-10Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TA96TA96Cicer arietinummarker_locus
TA96TA96-13.96Cicer arietinummarker_locus
TA96_olaTA96_olaCicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xILC3279-F2LG2N/A37.1TA96View
2chickpea-ICC4991xICCV04516-F2LG2N/A45.4TA96View
3chickpea-ICCV2xJG62-RILLG2N/A5.1TA96View
4chickpea-ICCV2xJG62-RILLG3N/A129.9TA96View
5chickpea-ICCV96029xCDCCorinne-F2LG2N/A52TA96View
6chickpea-ICCV96029xCDCFrontier-F2LG2N/A41.4TA96View
7chickpea-JG62xVijay-RIL-2011LG5N/A34.4TA96View
8chickpea-JG62xVijay-VijayxICC4958-RILLG3N/A10.8TA96View
9chickpea-ICC4958xPI489777-RIL-2011LG2N/A63.2TA96View
10chickpea-ICC4958xPI489777-RIL-2012LG2N/A64.8TA96View
11chickpea-ICCV2xJG62-RIL-F10-2011LGIIN/A26.6TA96View
12chickpea-ICC4958xPI489777-RIL-2012-2LG2N/A56.9TA96View
13chickpea-ICC4958xPI489777-RIL-F10LG2N/A56.33TA96View
14chickpea-ICCV96029xCDCFrontier-F2-2007LG2N/A41.4TA96View
15chickpea-HadasxICC5810-RILLG2N/A25.5TA96View
16chickpea-ICC4958xPI489777-RIL-F10-2012LG02N/A47.73TA96View
17chickpea-ICC3996xILWC184-F2LG2N/A0TA96View
18chickpea-ILC588xILC3279-RIL-F6LG2N/A0TA96View
19chickpea-ICC4958xPI489777-RIL-2010LG2N/A114.9TA96View
20chickpea-ICC4958xPI489777-RIL-2015-2LG2N/A68.59TA96View
21chickpea-ICCV96029×CDCFrontier-F2-2017CaLG02N/A5.1TA96View
22chickpea-ICC5810×CDCFrontier-F2-2017CaLG02N/A29TA96View
23chickpea-BGD132×CDCFrontier-F2-2017CaLG02N/A3.3TA96View
24chickpea-flowering_time_consensus_map-F2-2017CaLG02N/A28.9TA96View
25Chickpea-JG62xVijayxVijayxICC4958-RILLG3 (LGII+VIII)N/A10.8TA96View
26Chickpea-ICCL81001_x_Cr5-9-RILLG2N/A48TA96View
27Chickpea-JG62_X_WR315-RILLG2N/A19.7TA96View
28Chickpea-ICC4958× ICC1882-RILCaLG02N/A33.99TA96View
29Chickpea_SBD377_X_BGD112_RILLG5N/A85.6TA96View
30Chickpea-RIP12-OrtegaLG02N/A9.3TA96View
31Chickpea-RIP5-OrtegaLG02N/A11.3TA96View
32Chickpea-RIP8-OrtegaLG02-1N/A13.4TA96View
33Chickpea-SBD377/BGD112-RIL-High_densityLG05N/A75.07TA96View
34Chickpea-JG62/ICCV05530-RILLG02N/A13.96TA96-13.96View
35Chickpea-RIP5-OrtegaLG02N/A15TA96_olaView