TAA60, TAA60 (genetic_marker) Cicer arietinum

Marker Overview
NameTAA60
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(CTT)6; (CTT)9
Primer 1TAA60.Forward primer: TCATGCTTGTTGGTTAGCTAGAACAAA
Primer 2TAA60.Reverse primer: GACATAATCGAGTTAAAGAAAA
Product Length295
Publication[view all]
CommentMissing slash to separate primers; unsure if they are correct
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTAA60.Forward primerCicer arietinumprimer
Reverse primerTAA60.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TAA60TAA60Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material