TFFDMS71-TYPE-II, TFFDMS71-TYPE-II (genetic_marker) Cicer arietinum

Marker Overview
NameTFFDMS71-TYPE-II
Genbank IDPr016586152
TypeSSR
SpeciesCicer arietinum
GermplasmICC4958
Repeat Motif(AAC)5
Primer 1TFFDMS71-TYPE-II.Forward primer: CTCTCAACATCAACACTTTCC
Primer 2TFFDMS71-TYPE-II.Reverse primer: GAGAGATGCTATGTGTTTTGC
Product Length140
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankPr016586152
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTFFDMS71-TYPE-II.Forward primerCicer arietinumprimer
Reverse primerTFFDMS71-TYPE-II.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TFFDMS71-TYPE-IITFFDMS71-TYPE-IICicer arietinummarker_locus


Germplasm
Stock NameType
ICC4958cultivar
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Chickpea-ICCX-810800xICC 20268-RILCaChr1N/A4TFFDMS71-TYPE-IIView