TR1, TR1 (genetic_marker) Cicer arietinum

Marker Overview
NameTR1
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)31
Primer 1TR1.Forward primer: CGTATGATTTTGCCGTCTAT
Primer 2TR1.Reverse primer: ACCTCAAGTTCTCCGAAAGT
Product Length224
Publication[view all]
Comment17984
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TR1.Forward primerTR1.Forward primerCicer arietinumprimer
TR1.Reverse primerTR1.Reverse primerCicer arietinumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Plant widthqPLWTH.JG62xVijay.LG4.P.3Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TR1TR1Cicer arietinummarker_locus
TR1TR1-52.45Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material