TR13, TR13 (genetic_marker) Cicer arietinum

Marker Overview
NameTR13
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
Primer 1TR13.Forward Primer: CTTATTATTCAACTTCCATTTTGTT
Primer 2TR13.Reverse Primer: TTTGTAATTTATGACACATTAATAGTTAG
Publication[view all]
Relationships

This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICCV96029xCDCLuna.LG2Cicer arietinumQTL


This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerTR13.Forward PrimerCicer arietinumprimer
Reverse PrimerTR13.Reverse PrimerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TR13TR13Cicer arietinummarker_locus