TR19, TR19 (genetic_marker) Cicer arietinum

Name	TR19
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)27
Primer 1	TR19.Forward primer: TCAGTATCACGTGTAATTCGT
Primer 2	TR19.Reverse primer: CATGAACATCAAGTTCTCCA
Product Length	227
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2013	Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133.
2014	Patil B, Ravikumar R, Bhat J, Soregaon C. Molecular mapping of QTLs for resistance to early and late Fusarium wilt in chickpea. Czech journal of genetics and plant breeding. 2014; 50(2):171-176.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-C214xILC3279-F2	LG2	N/A	30.6	TR19	View
2	chickpea-C214xWR315-F2	LG2	N/A	23.8	TR19	View
3	chickpea-ICC4991xICCV04516-F2	LG2	N/A	0	TR19	View
4	chickpea-ICCV96029xAmit-F2	LG2	N/A	0	TR19	View
5	chickpea-ICCV96029xCDCCorinne-F2	LG2	N/A	38.7	TR19	View
6	chickpea-ICCV96029xCDCFrontier-F2	LG2	N/A	45.4	TR19	View
7	chickpea-ICCV96029xCDCLuna-F2	LG2	N/A	10.7	TR19	View
8	chickpea-ILC3279xICCV2-F3	LG2	N/A	25.7	TR19	View
9	chickpea-JG62xVijay-RIL-2011	LG5	N/A	62.7	TR19	View
10	chickpea-JG62xVijay-VijayxICC4958-RIL	LG3	N/A	39	TR19	View
11	chickpea-ICC4958xPI489777-RIL-2011	LG2	N/A	34.9	TR19	View
12	chickpea-ICC4958xPI489777-RIL-2012	LG2	N/A	49.5	TR19	View
13	chickpea-ICCV96029xCDCFrontier-F2-2007	LG2	N/A	45.4	TR19	View
14	chickpea-HadasxICC5810-RIL	LG2	N/A	13.7	TR19	View
15	chickpea-ILC3279xWR315-RIL-2007	LG2	N/A	36.7	TR19	View
16	chickpea-ICC4958xPI489777-RIL-F10-2012	LG02	N/A	30.03	TR19	View
17	chickpea-ICC12004xLasseter-F2	LGI	N/A	30.8	TR19	View
18	chickpea-ILC588xILC3279-RIL-F6	LG2	N/A	3.2	TR19	View
19	chickpea-ICC4958xPI489777-RIL-2010	LG2	N/A	38.3	TR19	View
20	chickpea-ICC4958xPI489777-RIL-2015-2	LG2	N/A	36.33	TR19	View
21	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG02	N/A	0	TR19	View
22	chickpea-ICC5810×CDCFrontier-F2-2017	CaLG02	N/A	20.9	TR19	View
23	chickpea-BGD132×CDCFrontier-F2-2017	CaLG02	N/A	0	TR19	View
24	chickpea-flowering_time_consensus_map-F2-2017	CaLG02	N/A	23.4	TR19	View
25	Chickpea-ICCL81001_x_Cr5-9-RIL	LG2	N/A	26.4	TR19	View
26	Chickpea-JG62_X_WR315-RIL	LG2	N/A	0	TR19	View
27	Chickpea-RIP12-Ortega	LG02	N/A	11.5	TR19	View
28	Chickpea-RIP5-Ortega	LG02	N/A	10.3	TR19	View
29	Chickpea-RIP8-Ortega	LG02-1	N/A	16	TR19	View
30	Chickpea-ICC4958/PI489777-RIL-2020	LG02	N/A	78.03	TR19	View
31	Chickpea-JG62/ICCV05530-RIL	LG02	N/A	8.3	TR19	View