TR2, TR2 (genetic_marker) Cicer arietinum

Marker Overview
NameTR2
AliasTR2s
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TTA)36
Primer 1TR2.Forward primer: GGCTTAGAGTTCAAAGAGAGAA
Primer 2TR2.Reverse primer: AACCAAGATTGGAAGTTGTG
Product Length210
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TR2.Forward primerTR2.Forward primerCicer arietinumprimer
TR2.Reverse primerTR2.Reverse primerCicer arietinumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Pod number per plantqPDPL.VijayxICC4958.LG7.IICicer arietinumQTL
Pod number per plantqPDPL.VijayxICC4958.LG7.IVCicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TR2TR2Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4991xICCV04516-F2LG2N/A64.7TR2View
2chickpea-ICCV2xJG62-F10-RILLG3N/A6TR2View
3chickpea-ICCV2xJG62-RILLG4N/A3.5TR2View
4chickpea-JG62xVijay-RIL-2011LG6N/A45.4TR2View
5chickpea-JG62xVijay-VijayxICC4958-RILLG6N/A45.4TR2View
6chickpea-VijayxICC4958-RIL-2011LG7N/A0TR2View
7chickpea-ICC4958xPI489777-RIL-2012LG3N/A129.32TR2View
8chickpea-ICC4958xPI489777-RIL-2012-2LG3N/A108TR2View
9chickpea-ICC4958xPI489777-RIL-F10LG3N/A37.96TR2View
10chickpea-ICC4958xPI489777-RIL-F10-2012LG03N/A54.19TR2View
11chickpea-ICC12004xLasseter-F2LGIN/A0TR2View
12chickpea-ICC4958xPI489777-RIL-2010LG3N/A60.3TR2View
13chickpea-ICC4958xPI489777-RIL-2015-2LG3N/A49.03TR2View
14Chickpea-JG62_X_WR315-RILLG2N/A45.5TR2View
15Chickpea-ICC4958× ICC1882-RILCaLG03N/A37.57TR2View