|
Marker Overview
Name | TR2 |
Genbank ID | N/A |
Type | STMS |
Species | Cicer arietinum |
Germplasm | ILC3279 |
Repeat Motif | (TTA)36 |
Primer 1 | TR2.Forward primer: GGCTTAGAGTTCAAAGAGAGAA |
Primer 2 | TR2.Reverse primer: AACCAAGATTGGAAGTTGTG |
Product Length | 210 |
Publication | [view all] |
Publications
Year | Publication |
1999 | Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101. |
2014 | Patil B, Ravikumar R, Bhat J, Soregaon C. Molecular mapping of QTLs for resistance to early and late Fusarium wilt in chickpea. Czech journal of genetics and plant breeding. 2014; 50(2):171-176. |
|