TR26, TR26 (genetic_marker) Cicer arietinum

Name	TR26
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(ATA)15
Primer 1	TR26.Forward primer: TCATCGCAGATGATGTAGAA
Primer 2	TR26.Reverse primer: TTGAACCTCAAGTTCTCTGG
Product Length	215
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICCV2xJG62-RIL	LG8	N/A	0	TR26	View
2	chickpea-ICCV96029xAmit-F2	LG3	N/A	44.9	TR26	View
3	chickpea-ICCV96029xCDCFrontier-F2	LG3	N/A	67.9	TR26	View
4	chickpea-JG62xVijay-RIL-2011	LG2	N/A	4.9	TR26	View
5	chickpea-JG62xVijay-VijayxICC4958-RIL	LG1	N/A	127.5	TR26	View
6	chickpea-ICC4958xPI489777-RIL-2012	LG3	N/A	69.4	TR26	View
7	chickpea-ICC4958xPI489777-RIL-2012-2	LG3	N/A	155.2	TR26	View
8	chickpea-ICC4958xPI489777-RIL-F10	LG3	N/A	67.72	TR26	View
9	chickpea-ICCV96029xCDCFrontier-F2-2007	LG3	N/A	67.9	TR26	View
10	chickpea-ICC4958xPI489777-RIL-F10-2012	LG03	N/A	79.62	TR26	View
11	chickpea-ILC588xILC3279-RIL-F6	LG3	N/A	22.8	TR26	View
12	chickpea-ICC4958xPI489777-RIL-2010	LG3	N/A	206.5	TR26	View
13	chickpea-ICC4958xPI489777-RIL-2015-2	LG3	N/A	23.58	TR26	View
14	Chickpea-RIP12-Ortega	LG07	N/A	2.5	TR26	View
15	Chickpea-RIP8-Ortega	LG03-2	N/A	22.7	TR26	View
16	Chickpea-ICC4958/PI489777-RIL-2020	LG03	N/A	130.75	TR26	View