TR3, TR3 (genetic_marker) Cicer arietinum

Marker Overview
NameTR3
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TTA)27
Primer 1TR3.Forward primer: GAAGTATCAGTATCACGTGTAATTCGT
Primer 2TR3.Reverse primer: CTTACGGAGAACATGAACATCAA
Product Length244
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTR3.Forward primerCicer arietinumprimer
Reverse primerTR3.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TR3TR3Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xWR315-F2LG2N/A25.2TR3View
2chickpea-ICC4991xICCV04516-F2LG2N/A6.6TR3View
3chickpea-ICC4958xPI489777-RIL-2012LG6N/A120.3TR3View
4chickpea-ICC4958xPI489777-RIL-2012-2LG6N/A140.8TR3View
5chickpea-HadasxICC5810-RILLG2N/A13.7TR3View