TR43, TR43 (genetic_marker) Cicer arietinum

Marker Overview
NameTR43
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)24
Primer 1TR43.Forward primer: AGGACGAAACTATTCAAGGTAAGTAGA
Primer 2TR43.Reverse primer: AATTGAGATGGTATTAAATGGATAACG
Product Length297
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTR43.Forward primerCicer arietinumprimer
Reverse primerTR43.Reverse primerCicer arietinumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TR43TR43Cicer arietinummarker_locus
TR43TR43-12.82Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-C214xWR315-F2LG1N/A37.2TR43View
2chickpea-ICC4991xICCV04516-F2LG1N/A41.9TR43View
3chickpea-ICCV2xJG62-RILLG1N/A5.6TR43View
4chickpea-ICCV96029xCDCCorinne-F2LG1N/A31.3TR43View
5chickpea-ICCV96029xCDCFrontier-F2LG1N/A27TR43View
6chickpea-JG62xVijay-VijayxICC4958-RILLG2N/A108.5TR43View
7chickpea-VijayxICC4958-RIL-2011LG1aN/A31.7TR43View
8chickpea-ICC4958xPI489777-RIL-2011LG1N/A50.1TR43View
9chickpea-ICC4958xPI489777-RIL-2012LG1N/A181.9TR43View
10chickpea-ICCV2xJG62-RIL-F10-2011LGIN/A52.4TR43View
11chickpea-ICC4958xPI489777-RIL-2012-2LG1N/A177TR43View
12chickpea-ICC4958xPI489777-RIL-F10LG1N/A50.45TR43View
13chickpea-ICCV96029xCDCFrontier-F2-2007LG1N/A27TR43View
14chickpea-HadasxICC5810-RILLG1N/A0TR43View
15chickpea-ICC4958xPI489777-RIL-F10-2012LG01N/A63.95TR43View
16chickpea-ICC12004xLasseter-F2LGIIN/A3.4TR43View
17chickpea-ICC3996xILWC184-F2LG1N/A11.4TR43View
18chickpea-ICC4958xPI489777-RIL-2010LG1N/A122.7TR43View
19chickpea-ICC4958xPI489777-RIL-2015-2LG1N/A32.07TR43View
20chickpea-ICCV96029×CDCFrontier-F2-2017CaLG01N/A1.2TR43View
21chickpea-ICC5810×CDCFrontier-F2-2017CaLG01N/A22.3TR43View
22chickpea-ICC16641×CDCFrontier-F2-2017CaLG01N/A34.1TR43View
23chickpea-flowering_time_consensus_map-F2-2017CaLG01N/A25.8TR43View
24Chickpea-JG62xVijayxVijayxICC4958-RILLG2 (LGI+IV)N/A108.5TR43View
25Chickpea-JG62/ICCV05530-RILLG01N/A12.82TR43-12.82View