TR56, TR56 (genetic_marker) Cicer arietinum

Marker Overview
NameTR56
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)21
Primer 1TR56.Forward primer: TTGATTCTCTCACGTGTAATTC
Primer 2TR56.Reverse primer: ATTTTGATTACCGTTGTGGT
Product Length248
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTR56.Forward primerCicer arietinumprimer
Reverse primerTR56.Reverse primerCicer arietinumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
100-seed weightqSDWT.JG62xVijay.LG1Cicer arietinumQTL
Days to 50% floweringqDFTFL.ILC588xILC3279.LG3.TH06Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LG3.TH06Cicer arietinumQTL
Harvest indexqHI.ILC588xILC3279.LG3.TH06Cicer arietinumQTL
Drought tolerance indexqDTI.ILC588xILC3279.LG3.TH06Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TR56TR56Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICCV96029xAmit-F2LG3N/A0TR56View
2chickpea-ICCV96029xCDCCorinne-F2LG3N/A94.1TR56View
3chickpea-ICCV96029xCDCFrontier-F2LG3N/A117.8TR56View
4chickpea-ICCV96029xCDCLuna-F2LG3N/A92.6TR56View
5chickpea-JG62xVijay-RIL-2011LG2N/A61.8TR56View
6chickpea-JG62xVijay-VijayxICC4958-RILLG1N/A67.7TR56View
7chickpea-ICC4958xPI489777-RIL-2012LG3N/A130TR56View
8chickpea-ICC4958xPI489777-RIL-2012-2LG3N/A105.8TR56View
9chickpea-ICC4958xPI489777-RIL-F10LG3N/A15.06TR56View
10chickpea-ICCV96029xCDCFrontier-F2-2007LG3N/A117.8TR56View
11chickpea-ICC4958xPI489777-RIL-F10-2012LG03N/A33.14TR56View
12chickpea-ICC12004xLasseter-F2LGIN/A197.7TR56View
13chickpea-ICC3996xILWC184-F2LG3N/A27.3TR56View
14chickpea-ILC588xILC3279-RIL-F6LG3N/A1.5TR56View
15chickpea-ICC4958xPI489777-RIL-2010LG3N/A61.4TR56View
16chickpea-ICC4958xPI489777-RIL-2015-2LG3N/A48.22TR56View
17Chickpea-JG62xVijayxVijayxICC4958-RILLG1 (LGIII+V+XIII)N/A67.7TR56View
18chickpea-ICCV96029×CDCFrontier-F2-2017CaLG03N/A3.3TR56View
19chickpea-ICC5810×CDCFrontier-F2-2017CaLG03N/A0TR56View
20chickpea-BGD132×CDCFrontier-F2-2017CaLG03N/A3.9TR56View
21chickpea-ICC16641×CDCFrontier-F2-2017CaLG03N/A4.1TR56View
22chickpea-flowering_time_consensus_map-F2-2017CaLG03N/A13.2TR56View
23Chickpea-ICCL81001_x_Cr5-9-RILLG3AN/A84.9TR56View
24Chickpea-ICC4958× ICC1882-RILCaLG03N/A48.91TR56View
25Chickpea_SBD377_X_BGD112_RILLG5N/A145.7TR56View
26Chickpea-RIP12-OrtegaLG03-2N/A13.7TR56View
27Chickpea-SBD377/BGD112-RIL-High_densityLG05N/A79.72TR56View
28Chickpea-ICC4958/PI489777-RIL-2020LG03N/A134.38TR56View