TR56, TR56 (genetic_marker) Cicer arietinum

Name	TR56
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)21
Primer 1	TR56.Forward primer: TTGATTCTCTCACGTGTAATTC
Primer 2	TR56.Reverse primer: ATTTTGATTACCGTTGTGGT
Product Length	248
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2007	Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216.
2015	Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICCV96029xAmit-F2	LG3	N/A	0	TR56	View
2	chickpea-ICCV96029xCDCCorinne-F2	LG3	N/A	94.1	TR56	View
3	chickpea-ICCV96029xCDCFrontier-F2	LG3	N/A	117.8	TR56	View
4	chickpea-ICCV96029xCDCLuna-F2	LG3	N/A	92.6	TR56	View
5	chickpea-JG62xVijay-RIL-2011	LG2	N/A	61.8	TR56	View
6	chickpea-JG62xVijay-VijayxICC4958-RIL	LG1	N/A	67.7	TR56	View
7	chickpea-ICC4958xPI489777-RIL-2012	LG3	N/A	130	TR56	View
8	chickpea-ICC4958xPI489777-RIL-2012-2	LG3	N/A	105.8	TR56	View
9	chickpea-ICC4958xPI489777-RIL-F10	LG3	N/A	15.06	TR56	View
10	chickpea-ICCV96029xCDCFrontier-F2-2007	LG3	N/A	117.8	TR56	View
11	chickpea-ICC4958xPI489777-RIL-F10-2012	LG03	N/A	33.14	TR56	View
12	chickpea-ICC12004xLasseter-F2	LGI	N/A	197.7	TR56	View
13	chickpea-ICC3996xILWC184-F2	LG3	N/A	27.3	TR56	View
14	chickpea-ILC588xILC3279-RIL-F6	LG3	N/A	1.5	TR56	View
15	chickpea-ICC4958xPI489777-RIL-2010	LG3	N/A	61.4	TR56	View
16	chickpea-ICC4958xPI489777-RIL-2015-2	LG3	N/A	48.22	TR56	View
17	Chickpea-JG62xVijayxVijayxICC4958-RIL	LG1 (LGIII+V+XIII)	N/A	67.7	TR56	View
18	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG03	N/A	3.3	TR56	View
19	chickpea-ICC5810×CDCFrontier-F2-2017	CaLG03	N/A	0	TR56	View
20	chickpea-BGD132×CDCFrontier-F2-2017	CaLG03	N/A	3.9	TR56	View
21	chickpea-ICC16641×CDCFrontier-F2-2017	CaLG03	N/A	4.1	TR56	View
22	chickpea-flowering_time_consensus_map-F2-2017	CaLG03	N/A	13.2	TR56	View
23	Chickpea-ICCL81001_x_Cr5-9-RIL	LG3A	N/A	84.9	TR56	View
24	Chickpea-ICC4958× ICC1882-RIL	CaLG03	N/A	48.91	TR56	View
25	Chickpea_SBD377_X_BGD112_RIL	LG5	N/A	145.7	TR56	View
26	Chickpea-RIP12-Ortega	LG03-2	N/A	13.7	TR56	View
27	Chickpea-SBD377/BGD112-RIL-High_density	LG05	N/A	79.72	TR56	View
28	Chickpea-ICC4958/PI489777-RIL-2020	LG03	N/A	134.38	TR56	View