TR7, TR7 (genetic_marker) Cicer arietinum

Name	TR7
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TTA)25
Primer 1	TR7.Forward primer: GCATTATTCACCATTTGGAT
Primer 2	TR7.Reverse primer: TGTGATAATTTTCTAAGTGTTTT
Product Length	204
Publication	[view all]
Contact	Vincent Vadez

Name	Details
Vincent Vadez	First name: Vincent Last name: Vadez Title: Researcher Institution: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) Address: International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Andhra Pradesh 502 324, India Country: India Email: v.vadez@cgiar.org

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2018	Sivasakthi K, Thudi M, Tharanya M, Kale SM, Kholová J, Halime MH, Jaganathan D, Baddam R, Thirunalasundari T, Gaur PM, Varshney RK, Vadez V. Plant vigour QTLs co-map with an earlier reported QTL hotspot for drought tolerance while water saving QTLs map in other regions of the chickpea genome. BMC plant biology. 2018 Feb 06; 18(1):29.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-ICCV96029xAmit-F2	LG6	N/A	45.8	TR7	View
2	chickpea-ICCV96029xCDCCorinne-F2	LG6	N/A	51.1	TR7	View
3	chickpea-ICCV96029xCDCFrontier-F2	LG6	N/A	128.8	TR7	View
4	chickpea-ICCV96029xCDCLuna-F2	LG6	N/A	40.3	TR7	View
5	chickpea-JG62xVijay-RIL-2011	LG4	N/A	53	TR7	View
6	chickpea-JG62xVijay-VijayxICC4958-RIL	LG4	N/A	37.4	TR7	View
7	chickpea-VijayxICC4958-RIL-2011	LG4	N/A	0	TR7	View
8	chickpea-ICC4958xPI489777-RIL-2012	LG6	N/A	196.1	TR7	View
9	chickpea-ICCV96029xCDCFrontier-F2-2007	LG6	N/A	128.8	TR7	View
10	chickpea-HadasxCr205-F2	LG6B	N/A	27.5	TR7	View
11	chickpea-ICC12004xLasseter-F2	LGV	N/A	18.1	TR7	View
12	chickpea-ICC3996xILWC184-F2	LG6	N/A	33.9	TR7	View
13	chickpea-ILC588xILC3279-RIL-F6	LG6	N/A	0.4	TR7	View
14	chickpea-ICC4958xPI489777-RIL-2015-2	LG6	N/A	82.82	TR7	View
15	Chickpea-ICC4958_x_ICC1882-RIL-2018	CaLG06	N/A	27.18	TR7	View
16	chickpea-ICC5810×CDCFrontier-F2-2017	CaLG06	N/A	29.3	TR7	View
17	chickpea-BGD132×CDCFrontier-F2-2017	CaLG06	N/A	29.1	TR7	View
18	chickpea-flowering_time_consensus_map-F2-2017	CaLG06	N/A	29.9	TR7	View
19	Chickpea-K850xWR315-RIL	LG4	N/A	38.3	TR7	View
20	Chickpea-ICC4958× ICC1882-RIL	CaLG06	N/A	17.1	TR7	View
21	Chickpea-ICC4958/PI489777-RIL-2020	LG06	N/A	184.74	TR7	View