TR8, TR8 (genetic_marker) Cicer arietinum

Marker Overview
NameTR8
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)22
Primer 1TR8.Forward primer: AGTTAAAGTCTTATTCGGTCAAAAACA
Primer 2TR8.Reverse primer: AAATACCAGGTTCATTGGAAGTAATC
Product Length221
Publication[view all]
ContactVincent Vadez
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTR8.Forward primerCicer arietinumprimer
Reverse primerTR8.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICCV96029xCDCLuna.LG4Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TR8TR8Cicer arietinummarker_locus


Contact
NameDetails
Vincent Vadez
First name:Vincent
Last name:Vadez
Title:Researcher
Institution:International Crops Research Institute for the Semi-Arid Tropics (ICRISAT)
Address:International Crops Research Institute for the Semi-Arid Tropics (ICRISAT), Patancheru, Andhra Pradesh 502 324, India
Country:India
Email:v.vadez@cgiar.org
Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1chickpea-ICC4991xICCV04516-F2LG1N/A0TR8View
2chickpea-ICCV2xJG62-RILLG6N/A10TR8View
3chickpea-ICCV96029xAmit-F2LG4N/A45.6TR8View
4chickpea-ICCV96029xCDCCorinne-F2LG4N/A7.9TR8View
5chickpea-ICCV96029xCDCFrontier-F2LG4N/A122.5TR8View
6chickpea-ICCV96029xCDCLuna-F2LG4N/A75.8TR8View
7chickpea-ILC3279xICCV2-F3LG4N/A37.5TR8View
8chickpea-ICCV2xJG62-RIL-F10-2011LGIVN/A50.7TR8View
9chickpea-ICCV96029xCDCFrontier-F2-2007LG4N/A122.5TR8View
10chickpea-ILC588xILC3279-RIL-F6LG4N/A0TR8View
11Chickpea-ICC4958_x_ICC1882-RIL-2018CaLG04N/A52.79TR8View
12Chickpea-ICC4958× ICC1882-RILCaLG04N/A60.16TR8View