TS19, TS19 (genetic_marker) Cicer arietinum

Marker Overview
NameTS19
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)27
Primer 1TS19.Forward primer: TTTCTTTTGTTAGAGTTAAAAAAAATT
Primer 2TS19.Reverse primer: TCTCATGTTTTGCTTTTTATTATTATTA
Product Length117
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
TS19.Forward primerTS19.Forward primerCicer arietinumprimer
TS19.Reverse primerTS19.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ICCV96029xCDCFrontier.LG3Cicer arietinumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Pod number per plantqPDPL.ILC588xILC3279.LGU.TH-cont10Cicer arietinumQTL
Days to 50% floweringqDFTFL.ILC588xILC3279.LGU.Terbol-09Cicer arietinumQTL
Days to 50% floweringqDFTFL.ILC588xILC3279.LGU.TH-Dr10Cicer arietinumQTL
Days to maturityqDM.ILC588xILC3279.LGU.TH-Dr10Cicer arietinumQTL
Empty pod numberqEPN.ILC588xILC3279.LGU.TH-cont10Cicer arietinumQTL
Biomass yield per plantqBYPL.ILC588xILC3279.LGU.Terbol-11Cicer arietinumQTL
Beta-carotene contentqBCARC.HadasxCr205.LGUCicer sp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TS19TS19Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material