|
Marker Overview
Name | TS43 |
Genbank ID | N/A |
Type | STMS |
Species | Cicer arietinum |
Germplasm | ILC3279 |
Repeat Motif | (ATT)33 |
Primer 1 | TS43.Forward primer: AAGTTTGGTCATAACACACATTCAATA |
Primer 2 | TS43.Reverse primer: TAAATTCACAAACTCAATTTATTGGC |
Product Length | 212 |
Publication | [view all] |
Publications
Year | Publication |
1999 | Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101. |
2013 | Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133. |
2007 | Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216. |
2015 | Gupta S, Kumar T, Verma S, Bharadwaj C, Bhatia S. Development of gene-based markers for use in construction of the chickpea (Cicer arietinum L.) genetic linkage map and identification of QTLs associated with seed weight and plant height. 2015 Oct 7. |
|