TS45, TS45 (genetic_marker) Cicer arietinum

Name	TS45
Genbank ID	N/A
Type	STMS
Species	Cicer arietinum
Germplasm	ILC3279
Repeat Motif	(TAA)8(A)3(TAA)18
Primer 1	TS45.Forward primer: TGACACAAAATTGTCTCTTGT
Primer 2	TS45.Reverse primer: TGTTCTTAACGTAACTAACCTAA
Product Length	244
Publication	[view all]

Year	Publication
1999	Winter P, Pfaff T, Udupa SM, Huttel B, Sharma PC, Sahi S, Arrequin-Espinoza R, Weigand F, Muehlbauer FJ, Kahl G. Characterization and mapping of sequence-tagged microsatellite sites in the chickpea (Cicer arietinum L.) genome. Mol Gen Genet. 1999; 262:90-101.
2013	Sabbavarapu MM, Sharma M, Chamarthi SK, Swapna N, Rathore A, Thudi M, Gaur PM, Pande S, Singh S, Kaur L, Varshney RK. Molecular mapping of QTLs for resistance to Fusarium wilt (race 1) and Ascochyta blight in chickpea (Cicer arietinum L.). Euphytica. 2013; 193(1):121-133.
2007	Radhika P, Gowda SJM, Kadoo NY, Mhase LB, Jamadagni BM, Sainani MN, Chandra S, Gupta VS. Development of an integrated intraspecific map of chickpea (Cicer arietinum L.) using two recombinant inbred line populations. Theoretical and applied genetics TAG. 2007; 115(2):209-216.

Stock Name	Type
ILC3279	accession

#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	chickpea-C214xILC3279-F2	LG8	N/A	21.2	TS45	View
2	chickpea-C214xWR315-F2	LG8	N/A	14	TS45	View
3	chickpea-ICC4991xICCV04516-F2	LG8A	N/A	0	TS45	View
4	chickpea-ICCV96029xCDCCorinne-F2	LG8	N/A	26.6	TS45	View
5	chickpea-ICCV96029xCDCFrontier-F2	LG8	N/A	33.7	TS45	View
6	chickpea-ICCV96029xCDCLuna-F2	LG8	N/A	4.1	TS45	View
7	chickpea-ILC3279xICCV2-F3	LG5	N/A	29.3	TS45	View
8	chickpea-JG62xVijay-RIL-2011	LG6	N/A	18	TS45	View
9	chickpea-JG62xVijay-VijayxICC4958-RIL	LG6	N/A	18	TS45	View
10	chickpea-ICC4958xPI489777-RIL-2011	LG8	N/A	30.6	TS45	View
11	chickpea-ICC4958xPI489777-RIL-2012	LG3	N/A	143	TS45	View
12	chickpea-ICC4958xPI489777-RIL-2012-2	LG8	N/A	75.3	TS45	View
13	chickpea-ICC4958xPI489777-RIL-F10	LG8	N/A	34.4	TS45	View
14	chickpea-ICCV96029xCDCFrontier-F2-2007	LG8	N/A	33.7	TS45	View
15	chickpea-HadasxCr205-F2	LG8B	N/A	23.8	TS45	View
16	chickpea-ICC4958xPI489777-RIL-F10-2012	LG08	N/A	30.13	TS45	View
17	chickpea-ICC12004xLasseter-F2	LGII	N/A	61.1	TS45	View
18	chickpea-ICC3996xILWC184-F2	LG8	N/A	23.9	TS45	View
19	chickpea-ICC4958xPI489777-RIL-2010	LG8	N/A	47.6	TS45	View
20	chickpea-ICC4958xPI489777-RIL-2015-2	LG8	N/A	47.49	TS45	View
21	chickpea-ICCV96029×CDCFrontier-F2-2017	CaLG08	N/A	21.5	TS45	View
22	chickpea-ICC5810×CDCFrontier-F2-2017	CaLG08	N/A	23.8	TS45	View
23	chickpea-ICC16641×CDCFrontier-F2-2017	CaLG08	N/A	19.8	TS45	View
24	chickpea-flowering_time_consensus_map-F2-2017	CaLG08	N/A	2.7	TS45	View
25	Chickpea-JG62xVijayxVijayxICC4958-RIL	LG6 (LGVIII)	N/A	18	TS45	View
26	Chickpea-JG62/ICCV05530-RIL	LG08	N/A	0	TS45	View
27	Chickpea-RIP12-Ortega	LG08	N/A	9	TS45	View
28	Chickpea-RIP5-Ortega	LG08-1	N/A	1.3	TS45	View
29	Chickpea-ICC4958/PI489777-RIL-2020	LG08	N/A	184.77	TS45	View