TS82, TS82 (genetic_marker) Cicer arietinum

Marker Overview
NameTS82
Genbank IDN/A
TypeSTMS
SpeciesCicer arietinum
GermplasmILC3279
Repeat Motif(TAA)6CAA(TAA)5TAT(TAA)5TAT(TAA)2TGA(TAA)4TGA(TAA)2
Primer 1TS82.Forward primer: CAAAGACATAATCGAGTTAAAGAAAAA
Primer 2TS82.Reverse primer: TGGTTAGCTAGAAAATTCAAGGG
Product Length295
Publication[view all]
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward primerTS82.Forward primerCicer arietinumprimer
Reverse primerTS82.Reverse primerCicer arietinumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Ascochyta blight resistanceqABR.ILC3279xWR315.LG2.2002Cicer arietinumQTL
Ascochyta blight resistanceqABR.ILC3279xWR315.LG2.2003Cicer arietinumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
TS82TS82Cicer arietinummarker_locus


Germplasm
Stock NameType
ILC3279breeding_research_material
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Chickpea-SBD377/BGD112-RIL-High_densityLG05N/A74.86TS82View
2Chickpea-RIP12-OrtegaLG02N/A11.1TS82View
3chickpea-C214xILC3279-F2LG2N/A19.2TS82View
4chickpea-C214xWR315-F2LG2N/A15.9TS82View
5chickpea-ICC4991xICCV04516-F2LG2N/A54TS82View
6chickpea-ICCV96029xCDCFrontier-F2LG2N/A72TS82View
7chickpea-ICCV96029xCDCLuna-F2LG2N/A4TS82View
8chickpea-ICC4958xPI489777-RIL-2011LG2N/A52.8TS82View
9chickpea-ICC4958xPI489777-RIL-2012LG2N/A63.3TS82View
10chickpea-ICC4958xPI489777-RIL-2012-2LG2N/A70.3TS82View
11chickpea-ICC4958xPI489777-RIL-F10LG2N/A53.24TS82View
12chickpea-ICCV96029xCDCFrontier-F2-2007LG2N/A72TS82View
13chickpea-ILC3279xWR315-RIL-2007LG2N/A49.5TS82View
14chickpea-ICC4958xPI489777-RIL-F10-2012LG02N/A45.89TS82View
15chickpea-ILC588xILC3279-RIL-F6LG2N/A8.2TS82View
16chickpea-ICC4958xPI489777-RIL-2010LG2N/A165.5TS82View
17chickpea-ICC4958xPI489777-RIL-2015-2LG2N/A69.56TS82View
18Chickpea-ICCL81001_x_Cr5-9-RILLG2N/A61.8TS82View
19Chickpea-JG62_X_WR315-RILLG2N/A144.8TS82View
20Chickpea_SBD377_X_BGD112_RILLG2N/A48.7TS82View