A3, A3 (genetic_marker) Pisum sativum

Marker Overview
NameA3
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1A3.Forward Primer: agcaatcttcgtctatatacctgg
Primer 2A3.Reverse Primer: attctctttcttgcgatctctg
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerA3.Forward PrimerPisum sativumprimer
Reverse PrimerA3.Reverse PrimerPisum sativumprimer