A5, A5 (genetic_marker) Pisum sativum

Marker Overview
NameA5
AliasPSMPA5
A5-172
A5-341
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1A5.Forward Primer: gtaaagcataaggggattctcat
Primer 2A5.Reverse Primer: cagcttttaactcatctgacaca
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerA5.Forward PrimerPisum sativumprimer
Reverse PrimerA5.Reverse PrimerPisum sativumprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Pea weevil resistanceqPWR.PennantxPI595933.LG5.COR5bPisum sp.QTL
Pea weevil resistanceqPWR.PennantxPI595933.LG5.SCR5bPisum sp.QTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
A5-172A5-172Pisum sativummarker_locus
A5-341A5-341Pisum sativummarker_locus
A5A5Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-ShawneexBohatyr-RILLGIIb.3N/A6.2A5-172View
2pea-microsatComposite-2005LGIIN/A187.1A5-172View
3pea-ShawneexBohatyr-RILLGVI.3N/A57.3A5-341View
4pea-microsatComposite-2005LGVIN/A51.5A5-341View
5pea-consensusMap-2011LGVIN/A53.3A5View
6pea-PennantxPI595933-F2LG5N/A144.7A5View
7Pea-HUVP1_x_FC1-RILLGVIN/A41.4A5View