A6, A6 (genetic_marker) Pisum sativum

Marker Overview
NameA6
AliasPSMPA6
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1A6.Forward Primer: cttaagagagattaaatggacaa
Primer 2A6.Reverse Primer: ccaactcataataaagattcaaa
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerA6.Forward PrimerPisum sativumprimer
Reverse PrimerA6.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
A6A6Pisum sativummarker_locus
PSMPA6PSMPA6Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-TeresexChampagne-RIL-2009LG3N/A300.9A6View
2pea-compositeMap-2006LGIIIN/A289.1A6View
3pea-TeresexChampagne-RILLGIIIb.2N/A139A6View
4pea-TeresexK586-RILLGIIIb.1N/A184.8A6View
5pea-consensusMap-2011LGIIIN/A263.1A6View
6pea-microsatComposite-2005LGIIIN/A283.4A6View
7pea-TeresexChampagne-RIL-2008LG3N/A300.9A6View
8pea-KaspaxParafield-RILLGIIIN/A7.4A6View
9Pea-Integrated_Map-Sudheesh-2015LG3N/A8.7A6View
10Pea-Composite_Map-Sudheesh-2015LG3N/A7.4A6View
11pea-DSPx90-2131-RIL-2015LGVIN/A193.7PSMPA6View