A8, A8 (genetic_marker) Pisum sativum

Marker Overview
NameA8
AliasPSMPA8
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1A8.Forward Primer: acaaagttaggtcatctatcca
Primer 2A8.Reverse Primer: catgcgacgttgttagtta
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerA8.Forward PrimerPisum sativumprimer
Reverse PrimerA8.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
A8A8Pisum sativummarker_locus
PSMPA8PSMPA8Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-consensusMap-2011LGVIIN/A146.3A8View
2pea-DSPx90-2131-RIL-2015LGVIIN/A190.6PSMPA8View