A9, A9 (genetic_marker) Pisum sativum

Marker Overview
NameA9
AliasPSMPA9
A9_359
A09_1250
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1A9.Forward Primer: gtgcagaagcatttgttcagat
Primer 2A9.Reverse Primer: cccacatatatttggttggtca
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerA9.Forward PrimerPisum sativumprimer
Reverse PrimerA9.Reverse PrimerPisum sativumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Seed weightqSDWGT.OSU442-15xPrimo.LGIVPisum sativumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
A9A9Pisum sativummarker_locus
PSMPA9PSMPA9Pisum sativummarker_locus
A9_359A9_359Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-TeresexChampagne-RILLGIVa.2N/A93.7A9View
2pea-ShawneexBohatyr-RILLGIVb.3N/A39.8A9View
3pea-consensusMap-2011LGIVN/A93.8A9View
4pea-microsatComposite-2005LGIVN/A62.1A9View
5pea-PennantxPI595933-F2LG7bN/A566A9View
6Pea-Integrated_Map-Sudheesh-2015LG4N/A226.71A9View
7Pea-Composite_Map-Sudheesh-2015LG4N/A223.22A9View
8Pea-Kaspa_x_PBA Oura-RILLG4AN/A70.8A9View
9pea-JI296xDP-RIL-2004LGIVN/A108PSMPA9View
10pea-DSPx90-2131-RIL-2015LGIVN/A96.6PSMPA9View
11pea-ShawneexBohatyr-F7-RILLGIVN/A80A9_359View