AA1, AA1 (genetic_marker) Pisum sativum

Marker Overview
NameAA1
AliasPSMPSAA1
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA1.Forward Primer: tccataatgcagcggaatgg
Primer 2AA1.Reverse Primer: gcatttagtgcagttgcaatctca
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA1.Forward PrimerPisum sativumprimer
Reverse PrimerAA1.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA1AA1Pisum sativummarker_locus
AA1-277AA1-277-62.6Pisum sativummarker_locus
AA1-277AA1-277-54.6Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-consensusMap-2011LGIIN/A64.8AA1View
2Pea-Integrated_Map-Sudheesh-2015LG2N/A122.06AA1View
3Pea-Composite_Map-Sudheesh-2015LG2N/A92.28AA1View
4Pea-Kaspa_x_PBA Oura-RILLG2N/A4.9AA1View
5Pea-Baccara/PI180693_Duarte-RIL-2016LGIIN/A62.6AA1-277-62.6View
6pea-BaccaraxPI180693-RILLGIIN/A62.6AA1-277-62.6View
7Pea-Baccara/PI180693_GBS-RIL-2016LGIIN/A54.6AA1-277-54.6View