AA103, AA103 (genetic_marker) Pisum sativum

Marker Overview
NameAA103
AliasPSMPSAA103
PSAA103
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA103.Forward Primer: aagtgtgaaagtttgccaggtc
Primer 2AA103.Reverse Primer: cgggtacgggttatgttgtc
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA103.Forward PrimerPisum sativumprimer
Reverse PrimerAA103.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA103AA103Pisum sativummarker_locus
PSMPSAA103PSMPSAA103Pisum sativummarker_locus
PSAA103PSAA103Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-compositeMap-2006LGVIN/A177.1AA103View
2pea-TeresexChampagne-RILLGVIb.2N/A19.2AA103View
3pea-ShawneexBohatyr-RILLGVI.3N/A158.2AA103View
4pea-TeresexK586-RILLGVI.1N/A145.5AA103View
5pea-consensusMap-2011LGVIN/A162.7AA103View
6pea-microsatComposite-2005LGVIN/A153.9AA103View
7pea-KaspaxParafield-RILLGVI.2N/A0AA103View
8Pea-Composite_Map-RILLGVIN/A134.2AA103View
9Pea-Integrated_Map-Sudheesh-2015LG6N/A12.06AA103View
10Pea-Composite_Map-Sudheesh-2015LG6N/A13.15AA103View
11Pea-Kaspa_x_PBA Oura-RILLG6AN/A2.5AA103View
12pea-JI296xDP-RIL-2004LGVIN/A4PSMPSAA103View
13pea-DSPx90-2131-RIL-2015LGVIN/A224.3PSAA103View