|
|
Marker Overview
| Name | AA103 |
|---|
| Alias | PSMPSAA103
PSAA103
|
|---|
| Genbank ID | N/A |
|---|
| Type | SSR |
|---|
| Species | Pisum sativum |
|---|
| Primer 1 | AA103.Forward Primer: aagtgtgaaagtttgccaggtc |
|---|
| Primer 2 | AA103.Reverse Primer: cgggtacgggttatgttgtc |
|---|
| Publication | [view all] |
|---|
| Comment | Agrogène; PSMPS prefix for marker |
|---|
Relationships
This genetic_marker is adjacent to the following primer feature(s):
| Feature Name | Unique Name | Species | Type |
|---|
| Forward Primer | AA103.Forward Primer | Pisum sativum | primer |
| Reverse Primer | AA103.Reverse Primer | Pisum sativum | primer |
The following marker_locus feature(s) are an instance of this genetic_marker:
Publications
| Year | Publication |
|---|
| 2005 | Loridon K, McPhee K, Morin J, Dubreuil P, Pilet-Nayel ML, Aubert G, Rameau C, Baranger A, Coyne C, Lejeune-Hènaut I, Burstin J. Microsatellite marker polymorphism and mapping in pea (Pisum sativum L.). TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2005 Oct; 111(6):1022-31. |
| 2014 | Duarte J, Riviere N, Barabger A, Aubert G, Burstin J, Cornet L, Lavaud C, Lejeune-Henaut I, Martinant JP, Pichon JP, Pilet-Nayel ML, Boutet G. Transcriptome sequencing for high throughput SNP development and genetic mapping in Pea. BMC Genomics. 2014; 15:126. |
| 2015 | Sudheesh S, Rodda M, Kennedy P, Verma P, Leonforte A, Cogan NOI, Materne M, Forster JW, Kaur S. Construction of an integrated linkage map and trait dissection for bacterial blight resistance in field pea (Pisum sativum L.). 2015; 35:185. |
Map Positions
| # | Map Name | Linkage Group | Bin | Position | Locus | MapViewer |
|---|
| 1 | pea-compositeMap-2006 | LGVI | N/A | 177.1 | AA103 | View |
| 2 | pea-TeresexChampagne-RIL | LGVIb.2 | N/A | 19.2 | AA103 | View |
| 3 | pea-ShawneexBohatyr-RIL | LGVI.3 | N/A | 158.2 | AA103 | View |
| 4 | pea-TeresexK586-RIL | LGVI.1 | N/A | 145.5 | AA103 | View |
| 5 | pea-consensusMap-2011 | LGVI | N/A | 162.7 | AA103 | View |
| 6 | pea-microsatComposite-2005 | LGVI | N/A | 153.9 | AA103 | View |
| 7 | pea-KaspaxParafield-RIL | LGVI.2 | N/A | 0 | AA103 | View |
| 8 | Pea-Composite_Map-RIL | LGVI | N/A | 134.2 | AA103 | View |
| 9 | Pea-Integrated_Map-Sudheesh-2015 | LG6 | N/A | 12.06 | AA103 | View |
| 10 | Pea-Composite_Map-Sudheesh-2015 | LG6 | N/A | 13.15 | AA103 | View |
| 11 | Pea-Kaspa_x_PBA Oura-RIL | LG6A | N/A | 2.5 | AA103 | View |
| 12 | pea-JI296xDP-RIL-2004 | LGVI | N/A | 4 | PSMPSAA103 | View |
| 13 | pea-DSPx90-2131-RIL-2015 | LGVI | N/A | 224.3 | PSAA103 | View |
|
