AA107, AA107 (genetic_marker) Pisum sativum

Marker Overview
NameAA107
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA107.Forward Primer: tgatgtaagttccgccgtgtat
Primer 2AA107.Reverse Primer: accgattttgatcattctctgg
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA107.Forward PrimerPisum sativumprimer
Reverse PrimerAA107.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA107AA107Pisum sativummarker_locus
AA107-303AA107-303-63.4Pisum sativummarker_locus
AA107-303AA107-303-60.4Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-compositeMap-2006LGIIIN/A96.5AA107View
2pea-TeresexChampagne-RILLGIIIa.2N/A106.6AA107View
3pea-TeresexK586-RILLGIIIb.1N/A17.9AA107View
4pea-consensusMap-2011LGIIIN/A78AA107View
5pea-microsatComposite-2005LGIIIN/A93.7AA107View
6Pea-Baccara/PI180693_Duarte-RIL-2016LGIIIN/A63.4AA107-303-63.4View
7pea-BaccaraxPI180693-RILLGIIIN/A63.4AA107-303-63.4View
8Pea-Baccara/PI180693_GBS-RIL-2016LGIIIN/A60.4AA107-303-60.4View