AA112, AA112 (genetic_marker) Pisum sativum

Marker Overview
NameAA112
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA112.Forward Primer: ctgctgctggaatacgaacaa
Primer 2AA112.Reverse Primer: cccatcccaatttttcacact
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA112.Forward PrimerPisum sativumprimer
Reverse PrimerAA112.Reverse PrimerPisum sativumprimer