AA121, AA121 (genetic_marker) Pisum sativum

Marker Overview
NameAA121
AliasPSAA121
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA121.Forward Primer: tccataccttagtgttaaa
Primer 2AA121.Reverse Primer: actaataaggtaaacatgtg
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA121.Forward PrimerPisum sativumprimer
Reverse PrimerAA121.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA121AA121Pisum sativummarker_locus
PSAA121PSAA121Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-TeresexChampagne-RIL-2009LG1N/A28.7AA121View
2pea-compositeMap-2006LGIN/A30AA121View
3pea-TeresexChampagne-RILLGI.2N/A1.8AA121View
4pea-ShawneexBohatyr-RILLGIa.3N/A0AA121View
5pea-TeresexK586-RILLGIa.1N/A10.2AA121View
6pea-consensusMap-2011LGIN/A16.3AA121View
7pea-microsatComposite-2005LGIN/A10.2AA121View
8Pea-Composite_Map-RILLGIN/A20.8AA121View
9Pea-Integrated_Map-Sudheesh-2015LG1N/A273.49AA121View
10Pea-Composite_Map-Sudheesh-2015LG1N/A297.58AA121View
11Pea-HUVP1_x_FC1-RILLGIN/A0AA121View
12pea-DSPx90-2131-RIL-2015LGIN/A0PSAA121View