AA135, AA135 (genetic_marker) Pisum sativum

Marker Overview
NameAA135
AliasAA135-291
PSMPSAA135
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA135.Forward Primer: ccgttacacatcattaagatg
Primer 2AA135.Reverse Primer: tccatatccagattagtcaga
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA135.Forward PrimerPisum sativumprimer
Reverse PrimerAA135.Reverse PrimerPisum sativumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Plant heightqPLHGT.JI296xDP.LGVII.ht3Pisum sativumQTL
Days to 50% floweringqDFTFL.JI296xDP.LGII.flo1Pisum sativumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA135-291AA135-291Pisum sativummarker_locus
PSMPSAA135PSMPSAA135Pisum sativummarker_locus
AA135AA135Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-ShawneexBohatyr-RILLGVII.3N/A24.2AA135-291View
2pea-microsatComposite-2005LGVIIN/A22.4AA135-291View
3pea-JI296xDP-F2:6-RILLG7N/A0PSMPSAA135View
4pea-JI296xDP-RIL-2004LGVIIN/A0PSMPSAA135View
5Pea-Integrated_Map-Sudheesh-2015LG7N/A345.41AA135View
6Pea-Composite_Map-Sudheesh-2015LG7N/A371.04AA135View
7Pea-Kaspa_x_PBA Oura-RILLG7N/A200.8AA135View
8Pea-HUVP1_x_FC1-RILLGVIIN/A0AA135View