AA153, AA153 (genetic_marker) Pisum sativum

Marker Overview
NameAA153
AliasAA153_253
AA153-370
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA153.Forward Primer: tttgatagtccgacttttccat
Primer 2AA153.Reverse Primer: gtgacaaaagaattcaaaacgc
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA153.Forward PrimerPisum sativumprimer
Reverse PrimerAA153.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA153_253AA153_253Pisum sativummarker_locus
AA153-370AA153-370Pisum sativummarker_locus
AA153AA153Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-OrbxCDCStriker-RILLGII-1N/A31.4AA153_253View
2pea-ShawneexBohatyr-RILLGIIa.3N/A89.2AA153-370View
3pea-microsatComposite-2005LGIIN/A103.9AA153-370View
4pea-PennantxPI595933-F2LG7aN/A384.9AA153View
5pea-KaspaxParafield-RILLGIIN/A116.9AA153View
6Pea-Integrated_Map-Sudheesh-2015LG2N/A143.49AA153View
7Pea-Composite_Map-Sudheesh-2015LG2N/A117.12AA153View