AA160, AA160 (genetic_marker) Pisum sativum

Marker Overview
NameAA160
AliasPSMPSAA160
PSAA160
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA160.Forward Primer: agatagacatgagaatggtggc
Primer 2AA160.Reverse Primer: ctgctccaacacaagataaaca
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA160.Forward PrimerPisum sativumprimer
Reverse PrimerAA160.Reverse PrimerPisum sativumprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA160AA160Pisum sativummarker_locus
PSMPSAA160PSMPSAA160Pisum sativummarker_locus
PSAA160PSAA160Pisum sativummarker_locus
AA160-374AA160-374-82.4Pisum sativummarker_locus
AA160-374AA160-374-73.4Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-TeresexChampagne-RIL-2009LG7N/A80.2AA160View
2Pea-IFPI3260/IFPI3251-RILLG01N/A148.56AA160View
3pea-compositeMap-2006LGVIIN/A106.2AA160View
4pea-TeresexChampagne-RILLGVIIa.2-LGVIIb.2N/A79.3AA160View
5pea-ShawneexBohatyr-RILLGVII.3N/A134.5AA160View
6pea-consensusMap-2011LGVIIN/A76.7AA160View
7pea-microsatComposite-2005LGVIIN/A113.9AA160View
8pea-PennantxPI595933-F2LG3N/A38.3AA160View
9pea-KaspaxParafield-RILLGVIIN/A132.7AA160View
10Pea-Integrated_Map-Sudheesh-2015LG7N/A207.05AA160View
11Pea-Composite_Map-Sudheesh-2015LG7N/A213.59AA160View
12Pea-Kaspa_x_PBA Oura-RILLG7N/A122.1AA160View
13pea-JI296xDP-RIL-2004LGVIIN/A66PSMPSAA160View
14pea-DSPx90-2131-RIL-2015LGVIIN/A107.6PSAA160View
15Pea-Baccara/PI180693_Duarte-RIL-2016LGVIIN/A82.4AA160-374-82.4View
16Pea-Baccara/PI180693_GBS-RIL-2016LGVIIN/A73.4AA160-374-73.4View