AA163.2, AA163.2 (genetic_marker) Pisum sativum

Marker Overview
NameAA163.2
AliasAA163_2
PSMPSAA163.2
PSAA163
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA163.2.Forward Primer: tagtttccaattcaatcgacca
Primer 2AA163.2.Reverse Primer: agtgtattgtaaatgcacaaggg
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA163.2.Forward PrimerPisum sativumprimer
Reverse PrimerAA163.2.Reverse PrimerPisum sativumprimer


This genetic_marker is adjacent to the following QTL feature(s):

Feature NameUnique NameSpeciesType
Mycosphaerella pinodes resistanceqMPR.JI296xDP.LGVa.mpVa-1.AUDPC.CC.stipulePisum sativumQTL
Mycosphaerella pinodes resistanceqMPR.JI296xDP.LGVa.mpVa-1.AUDPC.CC.stemPisum sativumQTL
Mycosphaerella pinodes resistanceqMPR.JI296xDP.LGVa.mpVa-1.AUDPC.FC.stemPisum sativumQTL


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Cold tolerance pqlqCTOLPQL.TeresexChampagne.LG5.L305Pisum sativumQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
AA163.2AA163.2Pisum sativummarker_locus
AA163_2AA163_2Pisum sativummarker_locus
PSMPSAA163.2PSMPSAA163.2Pisum sativummarker_locus
PSAA163PSAA163Pisum sativummarker_locus
AA163.2-317AA163.2-317-64.9Pisum sativummarker_locus
AA163.2-317AA163.2-317-59.5Pisum sativummarker_locus


Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1pea-TeresexChampagne-RIL-2009LG5N/A154.5AA163.2View
2pea-compositeMap-2006LGVN/A109.2AA163.2View
3pea-TeresexChampagne-RILLGV.2N/A96.1AA163.2View
4pea-TeresexK586-RILLGV.1N/A97.6AA163.2View
5pea-microsatComposite-2005LGVN/A100.3AA163.2View
6pea-TeresexChampagne-RIL-2008LG5N/A154.5AA163.2View
7pea-PennantxPI595933-F2LG5N/A105.3AA163.2View
8pea-KaspaxParafield-RILLGVN/A80.6AA163.2View
9Pea-Integrated_Map-Sudheesh-2015LG5N/A111.36AA163.2View
10Pea-Composite_Map-Sudheesh-2015LG5N/A98.87AA163.2View
11Pea-Kaspa_x_PBA Oura-RILLG5N/A60.9AA163.2View
12pea-consensusMap-2011LGVN/A139AA163_2View
13pea-JI296xDP-RIL-2004LGVaN/A75PSMPSAA163.2View
14pea-DSPx90-2131-RIL-2015LGVN/A66.9PSAA163View
15Pea-Baccara/PI180693_GBS-RIL-2016LGVN/A64.9AA163.2-317-64.9View
16Pea-Baccara/PI180693_Duarte-RIL-2016LGVN/A59.5AA163.2-317-59.5View