AA164, AA164 (genetic_marker) Pisum sativum

Marker Overview
NameAA164
Genbank IDN/A
TypeSSR
SpeciesPisum sativum
Primer 1AA164.Forward Primer: tcaatacacaatcaacatcacc
Primer 2AA164.Reverse Primer: gtgtcacattctgtcatgagtc
Publication[view all]
CommentAgrogène; PSMPS prefix for marker
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
Forward PrimerAA164.Forward PrimerPisum sativumprimer
Reverse PrimerAA164.Reverse PrimerPisum sativumprimer